eCollection 2023 May 23. DNA gyrase has two subunits (A and B) regulated by two genes ( gyr A and gyrB), with topoisomerase IV encoded by par C and parE genes. These results suggest that gyrase activity modulates DnaA association with oriC, which is consistent with the over-initiation phenotypes observed in oriC cells. 2B). These results altogether indicate that topoisomerase inhibition by novobiocin impacts replication initiation specifically from oriC. S2A). DNA clamp - Wikipedia Antibiotics: Precious Goods in Changing Times. These data suggest that changes in DNA topology impact replication initiation in vivo. Through binding to the GyrB subunit of gyrase at the ATP binding site, novobiocin blocks ATP hydrolysis, and enzymatic activity (33, 35). Initiation of replication of the Escherichia coli chromosomal origin reconstituted with purified enzymes. Primers HM20 (5 CGAAAAGAGGATTGTCCTTTCTGTCTGTCATTC 3) and HM21 (5 GAATGACAGACAGAAAGGACAATCCTCTTTTCG 3) were used to make the point mutation. DNA gyrase in M smegmatis and its possible involve- ment in phage I3 development. Goranov AI, Kuester-Schoeck E, Wang JD, Grossman AD. Given the global role of gyrase on chromosome topology, we cannot rule out the possibility that supercoiling effects on DnaA are indirect. Kumar D, Singhal C, Yadav M, Joshi P, Patra P, Tanwar S, Das A, Kumar Pramanik S, Chaudhuri S. Front Microbiol. Mol Microbiol. DNA polymerase will add the free DNA nucleotides using complementary base pairing (A-T and C-G) to the 3' end of the primer this will allow the new DNA strand to form. Soufo CD, Soufo HJD, Noirot-Gros MF, Steindorf A, Noirot P, Graumann PL. What does DNA gyrase do? Mutations that lead to novobiocin resistance can sometimes arise in the parE gene, which codes for one of the two subunits of Topo IV (36, 43). HHS Vulnerability Disclosure, Help To test if and how DNA topology impacts replication initiation in vivo, we measured the impact of novobiocin on initiation dynamics. Bookshelf HHS Vulnerability Disclosure, Help 2023;2601:3-26. doi: 10.1007/978-1-0716-2855-3_1. DNA gyrase and topoisomerases are enzymes involved in the crucial processes of DNA replication, transcription, and recombination. PCR and optical duplicates were then removed using Picard (61). FOIA eCollection 2022. Regulation of DnaA association and activity at the origin of replication, oriC, is the predominant mechanism of replication initiation control. 2022 Dec 20;66(12):e0092622. government site. For this, we measured expression levels of several known DnaA regulators with and without novobiocin. They are: Type I Type II DNA topoisomerases have been isolated from viral, prokaryotic, and eukaryotic sources. Sterlini JM, Mandelstam J. 2022 Aug;12(8):3201-3214. doi: 10.1016/j.apsb.2022.04.014. Currently, the fluoroquinolone class of antibacterials act via inhibition of the DNA gyrase enzyme. What does DNA gyrase do? | Homework.Study.com doi: 10.1101/cshperspect.a012922. 1997 Mar;5(3):102-9. doi: 10.1016/S0966-842X(96)10085-8. DNA Gyrase- Definition, Structure, Reactions, Mechanisms DNA gyrase: structure and function - PubMed Enrichment of the DUE was detected using primers HM459 (5-GGGAAAGTGTGAATAACTTTTCG -3) and 460 (5 - GTAGGGCCTGTGGATTTGTG -3). 2023 Feb 15;1274:134507. doi: 10.1016/j.molstruc.2022.134507. To further confirm that this is due to the activity of these proteins at oriC, we constructed yabA deletions in the oriN background and quantified survival of these mutants on novobiocin. 2018 Apr; 108(2): 115127. All of these observations point to a possible regulatory role for topology in DnaA binding and activity during replication initiation. Cultures were grown to exponential phase (optical density 0.30.5), set back to OD 0.05 in LB media and grown at 30C. oriN is the origin of replication used by pLS32, a plasmid present in Bacillus natto (a.k.a hay or grass Bacillus) (39, 40). Additionally, the mechanism of DnaA regulation is different in B. subtilis compared to E. coli: YabA disrupts oligomerization and cooperative binding of DnaA to the origin and this type of regulatory mechanism has not been reported for the key E. coli initiation regulators such as Hda, SeqA, or Dam (6). 2021 Feb;354(2):e2000277. Question: What role does gyrase play in DNA replication? - Chegg We did not detect any changes in expression profiles for these DnaA regulators after novobiocin treatment (Fig. Acta Pharm Sin B. However novobiocin demonstrates a high affinity for B. subtilis gyrase as well, suggesting that the preferential effect of novobiocin on B. subtilis gyrase is likely similar to that of E. coli (37). sharing sensitive information, make sure youre on a federal Interaction between DNA gyrase and quinolones: effects of alanine mutations at GyrA subunit residues Ser(83) and Asp(87). HM89 was constructed using site-directed mutagenesis by a previously described method (62). The rifamycins are a family of antibiotics that inhibit bacterial RNA polymerase. Additional experiments were performed to test if novobiocin-induced over-initiation could be leading to replication fork collapse. It is also involved in the repair of mismatches that occur during replication and double strand break repair.. One key feature known to be generally important for replication is DNA topology. Mid-exponential phase cultures (OD 0.30.5) were pelleted, LB supernatant was removed, and cells were back diluted (to OD 0.05) into 10 mL of sporulation media, using a previously described recipe (56). Two oppositely oriented arrays of low-affinity recognition sites in oriC guide progressive binding of DnaA during Escherichiacoli pre-RC assembly. Fuller RS, Kornberg A. Purified dnaA protein in initiation of replication at the Escherichia coli chromosomal origin of replication. If gyrase has an essential role in regulating DnaA-dependent initiation dynamics, then known regulators of DnaA may be important for modulating the impact of gyrase inhibition on replication initiation and survival. As expected, the novobiocin resistant mutant can grow on novobiocin, at concentrations which are lethal for wild-type cells. The resulting sam file was processed using SAMtools, view, and sort functions. The mechanism of action of inhibitors of DNA synthesis. Our understanding of these drug-enzyme interactions are based largely on studies performed in E. coli. Cultures were grown to OD 0.2, divided into 5mL cultures with no treatment, 0.50 g/mL novobiocin, 0.75 g/mL novobiocin, and 1 g/mL Mitomycin C. After 40 minutes of growth at 30C, cells were harvested in methanol (1:1 ratio) and pelleted. In addition, much attention has been focused on DNA gyrase as the intracellular target of a number of antibacterial agents as a paradigm for other DNA topoisomerases. Commitment to sporulation in. Reverse Transcriptase PCR was performed to make cDNA. These two pieces of rubber tubing represent each strand of a DNA duplex. 1AB), at around 36 and 340 degrees along the chromosome (Fig. Smits WK, Merrikh H, Bonilla CY, Grossman AD. FOIA WLS. Data shown are averages for at least 9 biological replicates, examined on 3 different days. Clipboard, Search History, and several other advanced features are temporarily unavailable. Quinolones are a key group of antibiotics that interfere with DNA synthesis by inhibiting topoisomerase, most frequently topoisomerase II (DNA gyrase), an enzyme involved in DNA replication. Leonard AC, Grimwade JE. These results argue against the model that gyrase inhibition targets DnaA-dependent initiation through arrest of replication elongation. DNA gyrase belongs to the group of topoisomerases that introduce negative supercoils to plasmid and chromosomal DNA. DnaA association with the DUE region could not be measured, as the DUE is deleted in this strain background. Topoisomerase- Definition, Types, Structure, Functions, Mechanism the contents by NLM or the National Institutes of Health. Topoisomerase IV can support oriC DNA replication in vitro. Cultures were started from single colonies and grown at 30C or 37C with aeration (260 rotations per minute), in LB broth, supplemented with 5 g/mL chloramphenicol, 50 g/mL spectinomycin, 2.5 g/mL kanamycin, or 250 ng/mL erythromycin and 6.25 g/mL lincomycin, when appropriate. Bethesda, MD 20894, Web Policies Epub 2022 Sep 7. The regulatory function of gyrase is specific to DnaA and oriC: replication initiation from an ectopic, DnaA-independent origin, oriN is unaffected by gyrase activity. To do this, wild-type exponential phase cells were plated on novobiocin. Synthesis, antimicrobial evaluation, DNA gyrase inhibition, and in silico pharmacokinetic studies of novel quinoline derivatives. (2) -bind to the backbone of single-stranded DNA -prevents the strands from pairing back together What is RNA primase? Therefore, though various studies have suggested that gyrase may influence replication initiation, the mechanism and potential role of gyrase as a regulator of DnaA binding or activity at oriC in vivo remain to be determined. Before Careers. Both yabA-aim expression and yabA over-expression were confirmed by measuring RNA levels (Fig. Wild-type exponential phase cells were plated on novobiocin. During the DNA replication, DNA helicase unwind . Whole genomic DNA was sonicated using a Covaris ultrasonicator and sequenced on an Illumina Next-Seq yielding approximately 15M reads. Topoisomerase IV tracks behind the replication fork and the SeqA The x-axis indicates chromosomal location, and the y-axis represents the abundance of reads relative to the total number of reads in the sequencing library. We measured DnaA association at two different loci within oriC: upstream of dnaA, (PdnaA), and at the DNA unwinding element (DUE) using anti-DnaA rabbit polyclonal antiserum. Design and Synthesis of 2-(4-Bromophenyl)Quinoline-4-Carbohydrazide Derivatives, Novel ciprofloxacin and norfloxacin-tetrazole hybrids as potential antibacterial and antiviral agents: Targeting. Interestingly, we found that strains initiating from oriN are significantly less sensitive to gyrase inhibition, showing minimal survival defects when plated on concentrations of novobiocin that reduce survival of wild-type cells by up to 3-logs (Fig. Error bars represent standard error of the mean. An official website of the United States government. DNA Gyrase and the Supercoiling of DNA | Science Error bars represent standard error of the mean. Cultures were grown to exponential phase (optical density 0.30.5), set back to OD 0.05 in LB media (with and without 1mM IPTG), and grown to OD=0.3. ISME J. Structural basis for ATP-dependent DnaA assembly and replication-origin remodeling. Initiation from oriN depends on the initiator protein RepN, which is also expressed in the strains we used in our experiments (Fig. Increased replication initiation generally leads to an increased ratio of origin to terminus DNA. YabA is a negative regulator of DnaA that lowers rates of replication initiation through disrupting oligomerization and cooperative binding of DnaA to oriC (46, 47) and tethering DnaA to the replisome (11). Deletion of yabA leads to over-initiation of replication, whereas over-expression of yabA inhibits this process (48). However, based on the marker frequency patterns presented, had Ogasawara and colleagues measured origin-to-terminus ratios, they would have likely seen an increase in initiation frequency similar to what we found. Funnell BE, Baker TA, Kornberg A. The site is secure. oriN cells do not use DnaA to initiate replication, therefore, one explanation for how gyrase might modulate initiation in an oriC-specific manner is through modulation of DnaA binding or activity. Freiesleben U, Von Rasmussen KV. 2014;14(1):130-51. doi: 10.2174/1568026613666131113153251. 2009 Oct;74(2):454-66. doi: 10.1111/j.1365-2958.2009.06876.x. Exposure of ssDNA presents several problems to the cell. Would you like email updates of new search results? Marker frequency ratios were determined by dividing the number of sequence reads quantified at each site (as indicated by the Cq values measured through qPCRs) by the number of sequence reads quantified at the terminus (using primers HM1585 and HM1586). The PubMed wordmark and PubMed logo are registered trademarks of the U.S. Department of Health and Human Services (HHS). The site is secure. Primers to amplify dnaK were HM770 (5 - TCTCCAGCTGTGATAAACGGTA 3) and HM771 (5 - AAAACGGCATTGATTTGTCA 3). Extensive unwinding of the plasmid template during staged enzymatic initiation of DNA replication from the origin of the Escherichia coli chromosome. Together, these results are consistent with our observations that replication elongation is largely unaltered in oriN cells upon topoisomerase inhibition. 1E). Gyrase belongs to a class of enzymes known as topoisomerases that are involved in the control of topological transitions of DNA. In contrast, we did not observe any change in origin-to-terminus ratios in the presence of novobiocin for the oriN cells (Fig. Unauthorized use of these marks is strictly prohibited. Bacillus subtilis HBsu Is Required for DNA Replication Initiation. Careers. These studies have established that a negatively supercoiled DNA template is required for replication initiation by DnaA from oriC in these reconstituted systems (1318). This is consistent with our findings using MMC. Cultures were grown to OD 0.2, divided into 5 mL cultures with no treatment, 0.50 g/mL novobiocin. These data are consistent with the findings presented above, and suggest that sensitivity to gyrase inhibition is strongly influenced by changes in regulation of DnaA association and activity at oriC. For example, recent work from E. coli suggest that gyrase promotes ATP hydrolysis by DnaA, at the DnaA sequestration locus, datA, which negatively regulates initiation (30). However, their efficacy is hindered by the increasing incidence of antimicrobial resistance. DNA gyrase controls replication initiation by inhibiting DnaA binding and activity at the origin of replication, oriC. D) Origin-to-terminus ratios for oriC and oriN cells with 0, 0.50, and 0.75 g/mL novobiocin, and with 1 g/mL MMC are plotted. Hull RC, Wright RCT, Sayers JR, Sutton JAF, Rzaska J, Foster SJ, Brockhurst MA, Condliffe AM. Cardoso-Ortiz J, Leyva-Ramos S, Baines KM, Gmez-Durn CFA, Hernndez-Lpez H, Palacios-Can FJ, Valcarcel-Gamio JA, Leyva-Peralta MA, Razo-Hernndez RS. Each strand in the double helix acts as a template for synthesis of a new, complementary strand. Rasmussen TS, Koefoed AK, Deng L, Muhammed MK, Rousseau GM, Kot W, Sprotte S, Neve H, Franz CMAP, Hansen AK, Vogensen FK, Moineau S, Nielsen DS. QPCR was done using SSoAdvanced SYBR Green master mix and CFX96 Touch Real-Time PCR system (Bio-Rad). 196 Another related enzyme, topoisomerase IV, also is required for segregation of bacterial genomes into two daughter cells during cell division. Bajad NG, Singh SK, Singh SK, Singh TD, Singh M. Curr Res Pharmacol Drug Discov. Bethesda, MD 20894, Web Policies What is the role of gyrase in DNA replication? - Studybuff.com DNA gyrase, a well-validated drug target, is involved in bacterial DNA replication, repair and decatenation. 1B). Rozgaja TA, Grimwade JE, Iqbal M, Czerwonka C, Vora M, Leonard AC. El-Shershaby MH, El-Gamal KM, Bayoumi AH, El-Adl K, Ahmed HEA, Abulkhair HS. Mode of action of novobiocin in Escherichia coli. Topoisomerase - Wikipedia 4A). Data shown are averages from 6 biological replicates. B) Marker frequency as measured by quantitative PCR at 0, 22.5, 45, 135, 225 (135), 315 (45), and 337.5 (22.5) degrees along the chromosome for oriC cells with and without 0.75 g/mL novobiocin treatment for 40 minutes. Louarn J, Bouch JP, Patte J, Louarn JM. The copy number of the origin and terminus were quantified by quantitative PCR (qPCR). This result is not surprising as replication and transcription can both be completely inhibited at high concentrations of novobiocin (32, 34). DNA gyrase is an essential bacterial enzyme that catalyzes the ATP-dependent negative super-coiling of double-stranded closed-circular DNA. Gyrase supercoils DNA by a mechanism called sign inversion, whereby a positive supercoil is directly inverted to a negative one by passing a DNA segment through a transient double-strand break. A) Colony forming units per mL on LB and LB supplemented with 0.45, 0.55, 0.65, 0.75, and 0.85 g/mL novobiocin were quantified. The site is secure. DNA gyrase, or simply gyrase, is an enzyme within the class of topoisomerase and is a subclass of Type II topoisomerases [1] that reduces topological strain in an ATP dependent manner while double-stranded DNA is being unwound by elongating RNA-polymerase [2] or by helicase in front of the progressing replication fork. An official website of the United States government. The over-initiation phenotype of oriC, Figure 2. Cells were pelleted and RNA was extracted using the Thermo Scientific GeneJET RNA Purification kit. The mutation in gyrB, R138L, was identified by amplification of gyrB by PCR, followed by sequencing. Single-Stranded Binding Protein (SSBP) SSBP means Single-Stranded Binding Proteins. Novobiocin is a useful tool for understanding the importance of DNA topology for essential processes, such as DNA replication and transcription (3134). Bethesda, MD 20894, Web Policies Careers. The upper chamber is composed primarily of the GyrB dimer (orange), which contains the binding site for ATP. Clipboard, Search History, and several other advanced features are temporarily unavailable. One critical factor in replication initiation and progression is DNA topology (7, 12, 13). Smith JL, Grossman AD. A) Plating efficiency of wild-type and gyrB (R138L) mutant cells on LB or LB supplemented with 0.45, 0.55, 0.65, 0.75, and 0.85 g/mL novobiocin were calculated. Novobiocin concentrations used include: 0.45, 0.55, 0.65, 0.75, and 0.85 g/mL. We propose a model where the topological status of the origin is used as a regulatory mechanism for DnaA binding at an early step prior to the melting of the origin. Stage two. Gyrase is a tetramer of the form A 2 B 2. To further clarify whether the oriC-specific effects of topoisomerase inhibition is due to a replication elongation block, we measured origin-to-terminus ratios for oriC and oriN cells in the presence and absence of the replication elongation inhibitor, Mitomycin C (MMC) (Fig. After this elongation, the RNA piece is removed by a 5' to 3' exonuclease and refilled with DNA. In agreement with this, transcription-induced negative supercoiling near oriC activates replication initiation in E. coli (22, 23). This mutation is in the same domain and the amino acid change is analogous to previously identified novobiocin resistant gyrase mutants in other bacteria (43, 44). This model can explain previous observations from studies in E. coli, where changes in DNA supercoiling or transcriptional activity at promoters near oriC were shown to impact replication initiation dynamics (22, 23, 52). 2022 Dec 5;17(23):e202200301. The gyrB mutant grew normally on LB supplemented with 0.45, 0.55, 0.65, 0.75, and 0.85 g/mL novobiocin, whereas the wild-type strain displayed 13-logs (or more) of killing when grown on these concentrations (Fig. Furthermore, in vitro studies suggest that negative supercoiling at the origin promotes replication initiation and increases DnaA binding (19, 20), although gyrase is not required for open complex formation or helicase loading (29). What is Helicase - Definition, Types, Function 2. The regulatory mechanisms for DnaA association and function with oriC in Bacillus subtilis and other Gram-positive bacteria are generally different than in Gram-negatives. 2022 Jul 19;12:900848. doi: 10.3389/fcimb.2022.900848. However, this unwinding activity by helicase accumulates a number of positive supertwisting in front of replication fork. DNA ligases in the repair and replication of DNA - PubMed In vitro, the type II topoisomerase DNA gyrase has been utilized to obtain the necessary supercoiling status for replication reactions to initiate and progress (1318). doi: 10.1128/mbio.01388-22. 1995 Dec 1;324(1):123-9. doi: 10.1006/abbi.1995.9919. CRISPR-Cas provides limited phage immunity to a prevalent gut bacterium in gnotobiotic mice. Donczew R, Mielke T, Jaworski P, Zakrzewska-Czerwiska J, Zawilak-Pawlik A. Regulation of DnaA association and activity at the origin of replication, oriC, is the predominant mechanism of replication initiation control. Primers HM3017 (5 GTGCTCACTGAAGACGATCTTCCC 3) and HM3018 (5 CATCTTCTTGAAGGGTTCCGAC 3) amplify DNA at position 225. In addition, we wanted to determine whether, specifically, the interaction of YabA with DnaA is important for novobiocin susceptibility. DNA primase is an enzyme involved in the replication of DNA and is a type of RNA polymerase.Primase catalyzes the synthesis of a short RNA (or DNA in some living organisms) segment called a primer complementary to a ssDNA (single-stranded DNA) template. 2021 Jun 21;22(12):6643. doi: 10.3390/ijms22126643. Asadi P, Khodamoradi E, Khodarahmi G, Jahanian-Najafabadi A, Marvi H, Dehghan Khalili S. Amino Acids. Overview of DNA Polymerase & RNA Polymerase - Study.com A) Marker frequency analysis as measured by deep sequencing for oriC cells with and without 0.75 g/mL novobiocin treatment for 40 minutes. 4B). Enzyme systems initiating replication at the origin of the Escherichia coli chromosome. 8600 Rockville Pike Our studies suggest that over-initiation becomes lethal if positive supercoiling is not resolved around the chromosome. Khan T, Sankhe K, Suvarna V, Sherje A, Patel K, Dravyakar B. Biomed Pharmacother. Hassan AKM, Moriya S, Ogura M, Tanaka T, Kawamura F, Ogasawara N. Suppression of initiation defects of chromosome replication in Bacillus subtilis dnaA and oriC-deleted mutants by integration of a plasmid replicon into the chromosomes. Enrichment of yhaX was detected using primers HM192 (5-CCGTCTGACCCGATCTTTTA-3) and HM193 (5-GTCATGCTGAATGTCGTGCT-3). Antimicrobial resistance is one of the greatest challenges facing the world today. 1.6: DNA Supercoiling and Topoisomerases - Biology LibreTexts Gellert M, Mizuuchi K, ODea MH, Nash HA. Replication initiation from oriC depends on ordered binding of the replication initiation protein, DnaA, to specific 9-mer consensus sequences (24). QPCR was done using SSoAdvanced SYBR Green master mix and CFX96 Touch Real-Time PCR system (Bio-Rad). Kaur G, Vora MP, Czerwonka CA, Rozgaja TA, Grimwade JE, Leonard AC. These values were normalized to ratios measured for sporulating B. subtilis cells. In order to ensure that secondary mutations are not responsible for the increase in novobiocin survival observed among the oriN strains, we sequenced the gyrB and parE genes, where mutations that lead to resistance usually arise in response to novobiocin treatment. 1D). Reads were mapped to the B. subtilis strain JH642 (GenBank: {"type":"entrez-nucleotide","attrs":{"text":"CP007800.1","term_id":"649009321"}}CP007800.1) genome using Bowtie 2 (60). Without gyrase, which regulates DNA topology by introducing negative supercoils and relieving excess positive supercoils ahead of replication forks (25, 26), replication cannot proceed (27, 28). What are the 6 Enzymes involved in DNA Replication? - Go Life Science In contrast to cells initiating replication from oriC, we did not observe any increase in novobiocin sensitivity in yabA deletion mutants initiating replication from oriN (Fig.
Buena Terra Elementary School Rating,
Patong Beach Bus Stop,
Summit Apartments Richmond, Va,
88 North St, Burlington, Vt,
What Stance Does Adams Take On Religion And Law?,
Articles W
